| Size | Price | |
|---|---|---|
| 500mg | ||
| 1g | ||
| Other Sizes |
| Targets |
Endogenous Metabolite
|
|---|---|
| ln Vitro |
We observed a significantly higher level of Palmitoylcarnitine/palcar in prostate cancerous tissue compared to benign tissue. High levels of palcar have been associated with increased gene expression and secretion of the pro‐inflammatory cytokine IL‐6 in cancerous PC3 cells, compared to normal PNT1A cells. Furthermore, we found that high levels of Palmitoylcarnitine/palcar induced a rapid Ca2+ influx in PC3 cells, but not in DU145, BPH‐1, or PNT1A cells. This pattern of Ca2+ influx was also observed in response to DHT. Through the use of whole genome arrays we demonstrated that PNT1A cells exposed to palcar or DHT have a similar biological response.
This study suggests that Palmitoylcarnitine/palcar might act as a potential mediator for prostate cancer progression through its effect on (i) pro‐inflammatory pathways, (ii) Ca2+ influx, and (iii) DHT‐like effects. Further studies need to be undertaken to explore whether this class of compounds has different biological functions at physiological and pathological levels [1]. |
| ln Vivo |
Palmitoyl-l-carnitine (PC) or L-palmitoylcarnitine, an ischemic metabolite, causes cellular Na+ and Ca2+ overload and cardiac dysfunction. This study determined whether ranolazine [(±)-1-piperazineacetamide, N-(2,6-dimethylphenyl)-4-[2-hydroxy-3-(2-methoxyphenoxy)propyl]-] attenuates PC-induced Na+ current and ventricular contractile dysfunction of the isolated heart. PC/L-palmitoylcarnitine (4 μM, 30 min) increased late Na+ current by 1034 ± 349% in guinea pig isolated ventricular myocytes; ranolazine (10 μM) and tetrodotoxin (TTX, 3 μM) significantly attenuated this effect of PC. PC increased left ventricular end-diastolic pressure (LVEDP), coronary perfusion pressure (CPP), wall stiffness, and cardiac lactate and adenosine release from the isolated heart. Ranolazine (10 μM) significantly reduced the PC-induced increase in LVEDP by 72 ± 6% (n = 6, p < 0.001), reduced left ventricular wall stiffness, and attenuated the PC-induced increase of CPP by 53 ± 10% (n = 6–7, p < 0.05). Ranolazine (10 μM) reduced the PC-induced increases of lactate and adenosine release by 70 ± 8 and 81 ± 5%, respectively (n = 6, p ≤ 0.05 for both). TTX (2 μM) significantly (p < 0.05) reduced PC-induced increases of CPP and LVEDP. Pretreatment of isolated myocytes or hearts with the free radical scavenger tiron (4,5-dihydroxy-1,3-benzenedisulfonic acid, disodium salt) (1 mM) significantly reduced the effects of PC to cause increases of late Na+ current and LVEDP, respectively, but unlike ranolazine or TTX, tiron did not reverse increases of late Na+ current and LVEDP caused by PC. In summary, ranolazine and TTX, inhibitors of the late Na+ current, attenuated the PC-induced ventricular contractile dysfunction and increase of coronary resistance in the guinea pig isolated heart [2].
|
| Cell Assay |
WST‐1 Viability Assay [1]
Cell viability in response to Palmitoylcarnitine/palcar was determined using WST‐1 viability assay. PNT1A and PC3 cells were seeded in 96‐well culture plates in a final volume of 100 μl/well culture medium and cultured in a humidified atmosphere (37°C, 5% CO2). Cells were allowed to adhere to the plate surface for 36 hr before being treated with palcar (0–100 μM) or vehicle control (DMSO) for 24 hr. Each dose of palcar was tested six times. WST‐1 reagent (10 μl) was added to each well and incubated for 30 min in a humidified atmosphere (37°C, 5% CO2). Quantification of the formazan dye produced by metabolically active cells was performed by a scanning multiwell spectrophotometer, measuring absorbance at 450 nm by microplate ELISA reader. Measuring IL‐6 Secretion in Response to Palmitoylcarnitine/Palcar [1] PNT1A, PC3, and LnCaP cells were grown to 70–80% confluence before being treated with palcar (0–100 μM) or vehicle control (DMSO) for 24 hr in a humidified atmosphere (37°C, 5% CO2). Supernatants were then collected and appropriately stored at −20°C until analysis. IL‐6 levels were quantified by using a commercially available ELISA kit following manufacturer's instructions. Measuring IL‐6 Gene Expression [1] PNT1A and PC3 cells were grown to 70–80% confluence before treatment with Palmitoylcarnitine/palcar (0–100 μM) or vehicle control (DMSO). The treatment was carried out for 24 hr in a humidified atmosphere (37°C, 5% CO2). Total RNA was extracted using RNeasy mini kit following the manufacturer's procedure. The quantity and quality of RNA was determined using RNA Nanodrop 1000. The ratio of 260/280 was 1.9–2.1 for all samples. IL‐6 gene expression was measured by real time RT‐PCR performed using an Applied Biosystems OneStep Plus real time RT‐PCR system on an optical 96‐well plate in a total volume of 20 μl/well, consisting of TaqMan 1‐step RT‐PCR master mix reagent kit, 20 ng total RNA, and IL‐6 primers and probes: IL‐6 forward sequence [5′‐CTCTTCAGAACGAATTGACAAACAAAT‐3, 100 μM, reverse sequence 5′‐ATGTTACTCTTGTTACATGTCTTCTTTCTC‐3, 100 μM and probe 5′‐TACATCCTCGACGGCATCTCAGCCC‐3′, 100 μM]. Reverse transcription was performed for 30 min at 48°C, amplification Taq activation for 10 min at 95°C, followed by 40 PCR cycles of denaturation at 95°C for 15 sec and annealing/extension at 60°C for 1 min. Reactions were carried out in triplicate and were normalized against an endogenous housekeeping gene, 18 S ribosomal RNA. The amount of mRNA and thus gene expression was quantified based on a standard curve method. Measuring Ca2+ Influx [1] Human prostate cells (PNT1A, BPH‐1, DU145, PC3) were cultured to 70–80% confluence, and then they were harvested by using trypsin. Cell suspension in 10% FBS‐supplemented media was centrifuged at 1,500 rpm for 3 min at room temperature. Cell pellet was re‐suspended in 10% FBS‐supplemented media and then incubated for 1 hr at 37°C and 5% CO2. Cells were counted and FURA‐2AM at the final concentration of 250 nM was added to the cell suspension (1 × 106 cells/ml) for 30 min at 37°C and 5% CO2. After washing, cells (100 μl) were seeded in a black 96‐well plate with clear bottom and were immediately treated with vehicle control, histamine (0–20 μM), Palmitoylcarnitine/palcar (0–50 μM) or DHT (0–1 μM). The kinetic of fluorescence was measured using a fluorescence plate reader at 510 nm (excitation) and at both 340 and 380 nm (emission) every 10 sec intervals for 5 min. Ca2+ influx has been expressed in terms of fluorescence ratio. Microarray Analysis [1] PNT1A cells were cultured to 70–80% confluence, and then they were treated with DMSO, Palmitoylcarnitine/palcar (0–5 μM) and DHT (10 nM) for 8 hr at 37°C and 5% CO2. RNA was extracted using RNeasy Mini kit as described in the manufacturer's instruction. RNA was quantified by using the Nanodrop 1000 spectrophotometer. RNA quality was analysed by using Agilent Bioanalyser. Gene expression profiling was performed using Affymetrix GeneChip Human Exon 1.0ST Array at Nottingham Arabidopsis Stock Centre following the Affymetrix protocols. Data were analysed using R/Bioconductor 32 and the aroma.affymetrix package 33. Data were robust multiple average (RMA) background‐corrected and quantile normalized. To obtain the gene‐level summaries, linear probe level models were applied to the data. For annotation, the current custom CDF file available at the aroma.affymetrix Web site containing the core probe sets (18708 transcript clusters; 284258 probe sets) was used. Subsequent statistical data analysis to identify differentially expressed genes was performed using limma 34. Genes were identified as differentially expressed at different Benjamini and Hochberg adjusted P values. To identify pathways that were the most over‐presented in the lists of differentially expressed genes, functional analyses using the Database for Annotation, Visualization and Integrated Discovery v6.7 |
| Animal Protocol |
This study determined whether ranolazine [(+/-)-1-piperazineacetamide, N-(2,6-dimethylphenyl)-4-[2-hydroxy-3-(2-methoxyphenoxy)propyl]-] attenuates PC (L-palmitoylcarnitine)-induced Na(+) current and ventricular contractile dysfunction of the isolated heart. PC/L-palmitoylcarnitine (4 microM, 30 min) increased late Na(+) current by 1034 +/- 349% in guinea pig isolated ventricular myocytes; ranolazine (10 microM) and tetrodotoxin (TTX, 3 microM) significantly attenuated this effect of PC. PC/L-palmitoylcarnitine increased left ventricular end-diastolic pressure (LVEDP), coronary perfusion pressure (CPP), wall stiffness, and cardiac lactate and adenosine release from the isolated heart [2].
|
| Toxicity/Toxicokinetics |
Subcutaneous LD50 in mice: 1 gm/kg Acta Biologica et Medica Germanica., 26(1237), 1971 [PMID:5153312]
|
| References |
|
| Additional Infomation |
In summary, these findings reveal significant differences in palcar levels between non-cancerous and cancerous prostate tissues, highlighting the potential application value of palcar profiling as a biomarker for prostate cancer-related metabolic disorders. In vitro experiments showed that high concentrations of palcar were associated with the induction of IL-6 and Ca2+ influx. The latter was also observed under DHT stimulation. Furthermore, genome-wide microarray analysis showed that, similar to DHT, low levels of palcar were associated with altered expression of many genes in non-cancerous prostate cells. Since DHT is a hormone associated with prostate growth, the DHT-like effect of palcar may suggest that palcar plays a potential role in inducing prostate cancer progression. [1]
|
| Molecular Formula |
C23H46CLNO4
|
|---|---|
| Molecular Weight |
436.068646907806
|
| Exact Mass |
435.311536
|
| CAS # |
28330-02-1
|
| Related CAS # |
28330-02-1; 2364-67-2; 6865-14-1; 18877-64-0; 1935-18-8
|
| PubChem CID |
20055580
|
| Appearance |
Typically exists as solids at room temperature
|
| LogP |
0
|
| Hydrogen Bond Donor Count |
1
|
| Hydrogen Bond Acceptor Count |
5
|
| Rotatable Bond Count |
20
|
| Heavy Atom Count |
29
|
| Complexity |
404
|
| Defined Atom Stereocenter Count |
1
|
| SMILES |
[Cl-].O(C(CCCCCCCCCCCCCCC)=O)[C@@H](CC(=O)O)C[N+](C)(C)C
|
| Synonyms |
28330-02-1; D-Palmitoylcarnitine chloride; PALMITOYL-D-CARNITINE CHLORIDE; [(2S)-3-carboxy-2-hexadecanoyloxypropyl]-trimethylazanium;chloride; (S)-3-Carboxy-N,N,N-trimethyl-2-(palmitoyloxy)propan-1-aminium chloride; starbld0008669; SCHEMBL2785480; D-Palmitoylcarnitine (chloride);
|
| HS Tariff Code |
2934.99.9001
|
| Storage |
Powder -20°C 3 years 4°C 2 years In solvent -80°C 6 months -20°C 1 month |
| Shipping Condition |
Room temperature (This product is stable at ambient temperature for a few days during ordinary shipping and time spent in Customs)
|
| Solubility (In Vitro) |
May dissolve in DMSO (in most cases), if not, try other solvents such as H2O, Ethanol, or DMF with a minute amount of products to avoid loss of samples
|
|---|---|
| Solubility (In Vivo) |
Note: Listed below are some common formulations that may be used to formulate products with low water solubility (e.g. < 1 mg/mL), you may test these formulations using a minute amount of products to avoid loss of samples.
Injection Formulations
Injection Formulation 1: DMSO : Tween 80: Saline = 10 : 5 : 85 (i.e. 100 μL DMSO stock solution → 50 μL Tween 80 → 850 μL Saline)(e.g. IP/IV/IM/SC) *Preparation of saline: Dissolve 0.9 g of sodium chloride in 100 mL ddH ₂ O to obtain a clear solution. Injection Formulation 2: DMSO : PEG300 :Tween 80 : Saline = 10 : 40 : 5 : 45 (i.e. 100 μL DMSO → 400 μLPEG300 → 50 μL Tween 80 → 450 μL Saline) Injection Formulation 3: DMSO : Corn oil = 10 : 90 (i.e. 100 μL DMSO → 900 μL Corn oil) Example: Take the Injection Formulation 3 (DMSO : Corn oil = 10 : 90) as an example, if 1 mL of 2.5 mg/mL working solution is to be prepared, you can take 100 μL 25 mg/mL DMSO stock solution and add to 900 μL corn oil, mix well to obtain a clear or suspension solution (2.5 mg/mL, ready for use in animals). View More
Injection Formulation 4: DMSO : 20% SBE-β-CD in saline = 10 : 90 [i.e. 100 μL DMSO → 900 μL (20% SBE-β-CD in saline)] Oral Formulations
Oral Formulation 1: Suspend in 0.5% CMC Na (carboxymethylcellulose sodium) Oral Formulation 2: Suspend in 0.5% Carboxymethyl cellulose Example: Take the Oral Formulation 1 (Suspend in 0.5% CMC Na) as an example, if 100 mL of 2.5 mg/mL working solution is to be prepared, you can first prepare 0.5% CMC Na solution by measuring 0.5 g CMC Na and dissolve it in 100 mL ddH2O to obtain a clear solution; then add 250 mg of the product to 100 mL 0.5% CMC Na solution, to make the suspension solution (2.5 mg/mL, ready for use in animals). View More
Oral Formulation 3: Dissolved in PEG400  (Please use freshly prepared in vivo formulations for optimal results.) |
| Preparing Stock Solutions | 1 mg | 5 mg | 10 mg | |
| 1 mM | 2.2932 mL | 11.4660 mL | 22.9321 mL | |
| 5 mM | 0.4586 mL | 2.2932 mL | 4.5864 mL | |
| 10 mM | 0.2293 mL | 1.1466 mL | 2.2932 mL |
*Note: Please select an appropriate solvent for the preparation of stock solution based on your experiment needs. For most products, DMSO can be used for preparing stock solutions (e.g. 5 mM, 10 mM, or 20 mM concentration); some products with high aqueous solubility may be dissolved in water directly. Solubility information is available at the above Solubility Data section. Once the stock solution is prepared, aliquot it to routine usage volumes and store at -20°C or -80°C. Avoid repeated freeze and thaw cycles.
Calculation results
Working concentration: mg/mL;
Method for preparing DMSO stock solution: mg drug pre-dissolved in μL DMSO (stock solution concentration mg/mL). Please contact us first if the concentration exceeds the DMSO solubility of the batch of drug.
Method for preparing in vivo formulation::Take μL DMSO stock solution, next add μL PEG300, mix and clarify, next addμL Tween 80, mix and clarify, next add μL ddH2O,mix and clarify.
(1) Please be sure that the solution is clear before the addition of next solvent. Dissolution methods like vortex, ultrasound or warming and heat may be used to aid dissolving.
(2) Be sure to add the solvent(s) in order.