| Size | Price | Stock | Qty |
|---|---|---|---|
| 1mg |
|
||
| 5mg |
|
||
| Other Sizes |
| Targets |
TLR9
ODN 1668 sodium targets Toll‑like receptor 9 (TLR9), an endosomal pattern recognition receptor (PRR) that recognizes unmethylated CpG dinucleotides. TLR9 is expressed in B cells and plasmacytoid dendritic cells (pDCs) in humans, and in B cells, macrophages, and conventional DCs in mice. ODN 1668 is a murine TLR9 agonist; it recognizes mouse TLR9 with high affinity but has reduced activity on human TLR9. Binding of ODN 1668 to TLR9 triggers the MyD88‑dependent signaling pathway, leading to activation of NF‑kappaB and the production of pro‑inflammatory cytokines (IL‑6, TNF‑alpha). |
|---|---|
| ln Vitro |
ODN 1668 sodium is a class B CpG ODN and a TLR9 agonist. It is an immunostimulatory sequence that activates B cells and promotes the production of pro‑inflammatory cytokines (IL‑6, TNF‑alpha). In vitro, ODN 1668 (1-10 uM) stimulates B cell proliferation and differentiation, and upregulates the expression of activation markers (CD86, MHC class II) on B cells and macrophages. In a humpback grouper model, ODN 1668 significantly enhanced antibacterial immunity in vivo and in head kidney lymphocytes (HKLs) in vitro. FITC‑ or biotin‑labeled ODN 1668 is available for cellular uptake studies.
|
| ln Vivo |
ODN 1668 sodium has been shown to act as a vaccine adjuvant, enhancing both humoral and cellular immune responses. In vivo, administration of ODN 1668 (50-200 ug/mouse, IP or SC) promotes Th1‑biased immune responses, increasing the production of IgG2a antibodies and activating CD8+ T cells. It also protects against bacterial and viral infections. In mice, intraperitoneal or subcutaneous injection of ODN 1668 (50-200 ug) induces systemic cytokine production (IL‑6, TNF‑alpha, IL‑12) and enhances the efficacy of co‑administered vaccines. In an antibacterial immunity study in humpback grouper, CpG ODN 1668 significantly enhanced antibacterial immune responses.
|
| Enzyme Assay |
The binding of ODN 1668 to TLR9 is measured by cell‑free assays using purified recombinant mouse TLR9 protein. A fluorescence polarization (FP) or time‑resolved fluorescence resonance energy transfer (TR‑FRET) assay is used. A labeled CpG ODN (e.g., FITC‑labeled ODN 1668) is used as a tracer. Unlabeled ODN 1668 is added at graded concentrations (0.1-10,000 nM) to compete for binding. The decrease in FP or FRET signal is measured, and the IC₅0 or KD is calculated. No specific KD values are reported. Purity is ≥98% (HPLC).
|
| Cell Assay |
For cellular assays, mouse splenocytes, B cells, or TLR9‑expressing cell lines (e.g., HEK‑Blue mTLR9 cells) are seeded in 96‑well plates (1-5 × 10⁵ cells/well). ODN 1668 is added at concentrations of 0.01-10 uM. After 6-48 h, cytokine production (IL‑6, TNF‑alpha, IL‑12, IFN‑gamma) in the supernatant is measured by ELISA. B cell proliferation is measured by [3H]‑thymidine incorporation or CFSE dilution. Activation of B cells and DCs is assessed by flow cytometry for CD86, CD40, and MHC class II expression. FITC‑labeled ODN 1668 is used to measure cellular uptake: cells are incubated with labeled ODN (1-10 uM) for 1-24 h, and fluorescence is measured by flow cytometry or confocal microscopy.
|
| Animal Protocol |
For in vivo evaluation of immunostimulatory activity, 6‑8‑week‑old female BALB/c or C57BL/6 mice are used. ODN 1668 sodium is administered intraperitoneally (IP) or subcutaneously (SC) at doses of 50-200 ug/mouse, either alone or co‑administered with an antigen (e.g., OVA). Blood is collected at 2, 6, 12, and 24 h post‑injection for measurement of serum cytokines (IL‑6, TNF‑alpha, IL‑12) by ELISA. Spleens are harvested for analysis of immune cell activation (e.g., CD86+ on DCs, CD69+ on B cells) by flow cytometry. In vaccine studies, mice are immunized on days 0, 14, and 28, and antigen‑specific antibody titers (IgG, IgG1, IgG2a) are measured by ELISA. For infection models (e.g., bacterial or viral challenge), mice are pre‑treated with ODN 1668 (50-100 ug/mouse, IP) and then infected; survival and pathogen load are assessed.
|
| ADME/Pharmacokinetics |
ODN 1668 sodium is a synthetic oligodeoxynucleotide (sequence: 5‘‑tccatgacgttcctgatgct‑3‘, MW approx. 6300 Da, phosphorothioate backbone). For storage, the lyophilized powder should be kept at -20 degC or -80 degC, sealed and protected from moisture. For in vitro use, stock solutions in sterile water or PBS (1-10 mg/mL) can be prepared and stored at -20 degC or -80 degC for up to 1 year. Avoid repeated freeze‑thaw cycles. For in vivo use, it is formulated in sterile PBS. No detailed PK parameters are reported.
|
| Toxicity/Toxicokinetics |
No specific toxicity data for ODN 1668 sodium are reported. As a potent immunostimulatory agent, its toxicity is associated with the risk of inducing uncontrolled systemic inflammation (cytokine storm) at high doses. In preclinical studies, doses up to 200 ug/mouse in C57BL/6 mice are generally tolerated without severe adverse effects. Standard laboratory safety precautions for handling nucleic acids should be followed. Not for human use.
|
| References | |
| Additional Infomation |
ODN 1668 sodium is a research‑grade class B CpG ODN. Class B CpG ODNs (e.g., ODN 1826, ODN 1668) strongly activate B cells and macrophages, promoting the production of IL‑6, TNF‑alpha, and IL‑12, but induce little IFN‑alpha from pDCs. ODN 1668 is a murine‑specific TLR9 agonist and is used extensively in mouse models to study the role of TLR9 in immunity, vaccine development, and cancer immunotherapy. The sodium salt form is used to improve solubility and stability. The compound is for research use only and has not received regulatory approval.
|
| Appearance |
Solid powder
|
|---|---|
| HS Tariff Code |
2934.99.9001
|
| Storage |
Powder -20°C 3 years 4°C 2 years In solvent -80°C 6 months -20°C 1 month Note: Please store this product in a sealed and protected environment, avoid exposure to moisture. |
| Shipping Condition |
Room temperature (This product is stable at ambient temperature for a few days during ordinary shipping and time spent in Customs)
|
| Solubility (In Vitro) |
May dissolve in DMSO (in most cases), if not, try other solvents such as H2O, Ethanol, or DMF with a minute amount of products to avoid loss of samples
|
|---|---|
| Solubility (In Vivo) |
Note: Listed below are some common formulations that may be used to formulate products with low water solubility (e.g. < 1 mg/mL), you may test these formulations using a minute amount of products to avoid loss of samples.
Injection Formulations
Injection Formulation 1: DMSO : Tween 80： Saline = 10 : 5 : 85 (i.e. 100 μL DMSO stock solution → 50 μL Tween 80 → 850 μL Saline)(e.g. IP/IV/IM/SC) *Preparation of saline: Dissolve 0.9 g of sodium chloride in 100 mL ddH ₂ O to obtain a clear solution. Injection Formulation 2: DMSO : PEG300 ：Tween 80 : Saline = 10 : 40 : 5 : 45 (i.e. 100 μL DMSO → 400 μLPEG300 → 50 μL Tween 80 → 450 μL Saline) Injection Formulation 3: DMSO : Corn oil = 10 : 90 (i.e. 100 μL DMSO → 900 μL Corn oil) Example: Take the Injection Formulation 3 (DMSO : Corn oil = 10 : 90) as an example, if 1 mL of 2.5 mg/mL working solution is to be prepared, you can take 100 μL 25 mg/mL DMSO stock solution and add to 900 μL corn oil, mix well to obtain a clear or suspension solution (2.5 mg/mL, ready for use in animals). View More
Injection Formulation 4: DMSO : 20% SBE-β-CD in saline = 10 : 90 [i.e. 100 μL DMSO → 900 μL (20% SBE-β-CD in saline)] Oral Formulations
Oral Formulation 1: Suspend in 0.5% CMC Na (carboxymethylcellulose sodium) Oral Formulation 2: Suspend in 0.5% Carboxymethyl cellulose Example: Take the Oral Formulation 1 (Suspend in 0.5% CMC Na) as an example, if 100 mL of 2.5 mg/mL working solution is to be prepared, you can first prepare 0.5% CMC Na solution by measuring 0.5 g CMC Na and dissolve it in 100 mL ddH2O to obtain a clear solution; then add 250 mg of the product to 100 mL 0.5% CMC Na solution, to make the suspension solution (2.5 mg/mL, ready for use in animals). View More
Oral Formulation 3: Dissolved in PEG400 (Please use freshly prepared in vivo formulations for optimal results.) |
Calculation results
Working concentration： mg/mL；
Method for preparing DMSO stock solution： mg drug pre-dissolved in μL DMSO (stock solution concentration mg/mL). Please contact us first if the concentration exceeds the DMSO solubility of the batch of drug.
Method for preparing in vivo formulation:：Take μL DMSO stock solution, next add μL PEG300, mix and clarify, next addμL Tween 80, mix and clarify, next add μL ddH2O，mix and clarify.
(1) Please be sure that the solution is clear before the addition of next solvent. Dissolution methods like vortex, ultrasound or warming and heat may be used to aid dissolving.
(2) Be sure to add the solvent(s) in order.
Products are for research use only; We do not sell to patients
Copyright 2020 InvivoChem LLC | All Rights Reserved
