yingweiwo

Bepirovirsen sodium (ISIS 505358 sodium)

Cat No.:V83851 Purity: ≥98%
Bepirovirsen sodium (ISIS 505358 sodium)
Bepirovirsen sodium (ISIS 505358 sodium) Chemical Structure CAS No.: 2563929-84-8
Product category: HBV
This product is for research use only, not for human use. We do not sell to patients.
Size Price Stock Qty
1mg
5mg
10mg
Other Sizes
Official Supplier of:
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text
Alternate Text

 

  • Business Relationship with 5000+ Clients Globally
  • Major Universities, Research Institutions, Biotech & Pharma
  • Citations by Top Journals: Nature, Cell, Science, etc.
Top Publications Citing lnvivochem Products
Product Description
Bepirovirsen sodium is an antisense oligonucleotide that targets all HBV messenger RNAs. Bepirovirsen causes a reduction in HBV-derived RNAs, HBV DNA, and viral proteins. Bepirovirsen sodium can be used in the study of chronic HBV infection. Bepirovirsen binding site sequence (GCACTTCGCTTCACCTCTGC).
Bepirovirsen sodium (ISIS 505358 sodium) is an antisense oligonucleotide targeting all HBV messenger RNAs. It leads to reductions in HBV-derived RNAs, HBV DNA, and viral proteins. It can be used for the research of chronic HBV infection. It has CAS number 2563929-84-8. It is intended for research use only and is not for human therapeutic applications.
Biological Activity I Assay Protocols (From Reference)
Targets
Bepirovirsen sodium targets all HBV messenger RNAs. As an antisense oligonucleotide, it binds to HBV mRNA transcripts through complementary base pairing, leading to their degradation or inhibition of translation. This results in reductions in HBV-derived RNAs, HBV DNA, and viral proteins. By targeting all HBV mRNAs, the compound achieves broad antiviral activity against hepatitis B virus.
ln Vitro
In vitro studies demonstrate that Bepirovirsen sodium is an antisense oligonucleotide that targets all HBV messenger RNAs. It leads to reductions in HBV-derived RNAs, HBV DNA, and viral proteins. The compound shows antiviral activity against hepatitis B virus in cell-based systems. Detailed in vitro activity data, including IC50 values and knockdown efficiency, are not extensively documented in the available literature.
ln Vivo
In vivo activity of Bepirovirsen sodium has been investigated in the context of chronic HBV infection. As an antisense oligonucleotide targeting all HBV mRNAs, it reduces HBV-derived RNAs, HBV DNA, and viral proteins in vivo. The compound has been studied in preclinical models and clinical trials for the treatment of chronic hepatitis B. Detailed in vivo data are available from the literature.
Enzyme Assay
The in vitro assay for Bepirovirsen sodium involves measuring its ability to reduce HBV RNA, HBV DNA, and viral protein levels. Cells infected with HBV are treated with the antisense oligonucleotide, and HBV RNA levels are measured by qPCR, HBV DNA by qPCR or Southern blot, and viral proteins by ELISA or Western blot. Standard protocols include appropriate controls such as scrambled oligonucleotides and vehicle controls.
Cell Assay
In vitro cell-based assays for Bepirovirsen sodium are conducted using HBV-infected cell lines such as HepG2.2.15 cells. Cells are treated with the compound at various concentrations, and HBV RNA, HBV DNA, and viral protein levels are measured. Cytotoxicity is evaluated using standard cell viability assays. Standard protocols include appropriate positive controls such as known anti-HBV agents and vehicle controls.
Animal Protocol
In vivo animal studies for Bepirovirsen sodium have been conducted using HBV transgenic mouse models or other HBV infection models. Animals are administered the compound via appropriate routes, and HBV RNA, HBV DNA, and viral protein levels in serum and liver tissues are measured. Pharmacokinetic parameters are determined from plasma samples. The compound has also been evaluated in clinical trials for chronic HBV infection.
ADME/Pharmacokinetics
Pharmacokinetic properties of Bepirovirsen sodium are typical of antisense oligonucleotides. As a nucleic acid-based compound, it is subject to degradation by nucleases in biological fluids. The compound has CAS number 2563929-84-8. Detailed pharmacokinetic parameters such as half-life, bioavailability, and tissue distribution are not extensively documented in the available literature. The compound is intended for research use only.
Toxicity/Toxicokinetics
Toxicity information for Bepirovirsen sodium is limited. As a research-use compound, standard safety precautions for handling should be followed. The compound is designated for research use only and is not for human therapeutic applications. No detailed toxicity data are available from the search results.
References

[1].Safety, tolerability and antiviral activity of the antisense oligonucleotide bepirovirsen in patients with chronic hepatitis B: a phase 2 randomized controlled trial. Nat Med. 2021 Oct;27(10):1725-1734.

Additional Infomation
Bepirovirsen sodium (ISIS 505358 sodium) is an antisense oligonucleotide targeting all HBV mRNAs. It leads to reductions in HBV-derived RNAs, HBV DNA, and viral proteins. It is used for research of chronic HBV infection. CAS 2563929-84-8. It is intended for research use only.
These protocols are for reference only. InvivoChem does not independently validate these methods.
Physicochemical Properties
Molecular Formula
C230H290N88NA19O115P19S19
Molecular Weight
7762.00
CAS #
2563929-84-8
Appearance
White to off-white solid powder
HS Tariff Code
2934.99.9001
Storage

Powder      -20°C    3 years

                     4°C     2 years

In solvent   -80°C    6 months

                  -20°C    1 month

Note: Please store this product in a sealed and protected environment (e.g. under nitrogen), avoid exposure to moisture.
Shipping Condition
Room temperature (This product is stable at ambient temperature for a few days during ordinary shipping and time spent in Customs)
Solubility Data
Solubility (In Vitro)
Typically soluble in DMSO (e.g. 10 mM)
Solubility (In Vivo)
Note: Listed below are some common formulations that may be used to formulate products with low water solubility (e.g. < 1 mg/mL), you may test these formulations using a minute amount of products to avoid loss of samples.

Injection Formulations
(e.g. IP/IV/IM/SC)
Injection Formulation 1: DMSO : Tween 80: Saline = 10 : 5 : 85 (i.e. 100 μL DMSO stock solution 50 μL Tween 80 850 μL Saline)
*Preparation of saline: Dissolve 0.9 g of sodium chloride in 100 mL ddH ₂ O to obtain a clear solution.
Injection Formulation 2: DMSO : PEG300Tween 80 : Saline = 10 : 40 : 5 : 45 (i.e. 100 μL DMSO 400 μLPEG300 50 μL Tween 80 450 μL Saline)
Injection Formulation 3: DMSO : Corn oil = 10 : 90 (i.e. 100 μL DMSO 900 μL Corn oil)
Example: Take the Injection Formulation 3 (DMSO : Corn oil = 10 : 90) as an example, if 1 mL of 2.5 mg/mL working solution is to be prepared, you can take 100 μL 25 mg/mL DMSO stock solution and add to 900 μL corn oil, mix well to obtain a clear or suspension solution (2.5 mg/mL, ready for use in animals).
View More

Injection Formulation 4: DMSO : 20% SBE-β-CD in saline = 10 : 90 [i.e. 100 μL DMSO 900 μL (20% SBE-β-CD in saline)]
*Preparation of 20% SBE-β-CD in Saline (4°C,1 week): Dissolve 2 g SBE-β-CD in 10 mL saline to obtain a clear solution.
Injection Formulation 5: 2-Hydroxypropyl-β-cyclodextrin : Saline = 50 : 50 (i.e. 500 μL 2-Hydroxypropyl-β-cyclodextrin 500 μL Saline)
Injection Formulation 6: DMSO : PEG300 : castor oil : Saline = 5 : 10 : 20 : 65 (i.e. 50 μL DMSO 100 μLPEG300 200 μL castor oil 650 μL Saline)
Injection Formulation 7: Ethanol : Cremophor : Saline = 10: 10 : 80 (i.e. 100 μL Ethanol 100 μL Cremophor 800 μL Saline)
Injection Formulation 8: Dissolve in Cremophor/Ethanol (50 : 50), then diluted by Saline
Injection Formulation 9: EtOH : Corn oil = 10 : 90 (i.e. 100 μL EtOH 900 μL Corn oil)
Injection Formulation 10: EtOH : PEG300Tween 80 : Saline = 10 : 40 : 5 : 45 (i.e. 100 μL EtOH 400 μLPEG300 50 μL Tween 80 450 μL Saline)


Oral Formulations
Oral Formulation 1: Suspend in 0.5% CMC Na (carboxymethylcellulose sodium)
Oral Formulation 2: Suspend in 0.5% Carboxymethyl cellulose
Example: Take the Oral Formulation 1 (Suspend in 0.5% CMC Na) as an example, if 100 mL of 2.5 mg/mL working solution is to be prepared, you can first prepare 0.5% CMC Na solution by measuring 0.5 g CMC Na and dissolve it in 100 mL ddH2O to obtain a clear solution; then add 250 mg of the product to 100 mL 0.5% CMC Na solution, to make the suspension solution (2.5 mg/mL, ready for use in animals).
View More

Oral Formulation 3: Dissolved in PEG400
Oral Formulation 4: Suspend in 0.2% Carboxymethyl cellulose
Oral Formulation 5: Dissolve in 0.25% Tween 80 and 0.5% Carboxymethyl cellulose
Oral Formulation 6: Mixing with food powders


Note: Please be aware that the above formulations are for reference only. InvivoChem strongly recommends customers to read literature methods/protocols carefully before determining which formulation you should use for in vivo studies, as different compounds have different solubility properties and have to be formulated differently.

 (Please use freshly prepared in vivo formulations for optimal results.)
Preparing Stock Solutions 1 mg 5 mg 10 mg
1 mM 0.1288 mL 0.6442 mL 1.2883 mL
5 mM 0.0258 mL 0.1288 mL 0.2577 mL
10 mM 0.0129 mL 0.0644 mL 0.1288 mL

*Note: Please select an appropriate solvent for the preparation of stock solution based on your experiment needs. For most products, DMSO can be used for preparing stock solutions (e.g. 5 mM, 10 mM, or 20 mM concentration); some products with high aqueous solubility may be dissolved in water directly. Solubility information is available at the above Solubility Data section. Once the stock solution is prepared, aliquot it to routine usage volumes and store at -20°C or -80°C. Avoid repeated freeze and thaw cycles.

Calculator

Molarity Calculator allows you to calculate the mass, volume, and/or concentration required for a solution, as detailed below:

  • Calculate the Mass of a compound required to prepare a solution of known volume and concentration
  • Calculate the Volume of solution required to dissolve a compound of known mass to a desired concentration
  • Calculate the Concentration of a solution resulting from a known mass of compound in a specific volume
An example of molarity calculation using the molarity calculator is shown below:
What is the mass of compound required to make a 10 mM stock solution in 5 ml of DMSO given that the molecular weight of the compound is 350.26 g/mol?
  • Enter 350.26 in the Molecular Weight (MW) box
  • Enter 10 in the Concentration box and choose the correct unit (mM)
  • Enter 5 in the Volume box and choose the correct unit (mL)
  • Click the “Calculate” button
  • The answer of 17.513 mg appears in the Mass box. In a similar way, you may calculate the volume and concentration.

Dilution Calculator allows you to calculate how to dilute a stock solution of known concentrations. For example, you may Enter C1, C2 & V2 to calculate V1, as detailed below:

What volume of a given 10 mM stock solution is required to make 25 ml of a 25 μM solution?
Using the equation C1V1 = C2V2, where C1=10 mM, C2=25 μM, V2=25 ml and V1 is the unknown:
  • Enter 10 into the Concentration (Start) box and choose the correct unit (mM)
  • Enter 25 into the Concentration (End) box and select the correct unit (mM)
  • Enter 25 into the Volume (End) box and choose the correct unit (mL)
  • Click the “Calculate” button
  • The answer of 62.5 μL (0.1 ml) appears in the Volume (Start) box
g/mol

Molecular Weight Calculator allows you to calculate the molar mass and elemental composition of a compound, as detailed below:

Note: Chemical formula is case sensitive: C12H18N3O4  c12h18n3o4
Instructions to calculate molar mass (molecular weight) of a chemical compound:
  • To calculate molar mass of a chemical compound, please enter the chemical/molecular formula and click the “Calculate’ button.
Definitions of molecular mass, molecular weight, molar mass and molar weight:
  • Molecular mass (or molecular weight) is the mass of one molecule of a substance and is expressed in the unified atomic mass units (u). (1 u is equal to 1/12 the mass of one atom of carbon-12)
  • Molar mass (molar weight) is the mass of one mole of a substance and is expressed in g/mol.
/

Reconstitution Calculator allows you to calculate the volume of solvent required to reconstitute your vial.

  • Enter the mass of the reagent and the desired reconstitution concentration as well as the correct units
  • Click the “Calculate” button
  • The answer appears in the Volume (to add to vial) box
In vivo Formulation Calculator (Clear solution)
Step 1: Enter information below (Recommended: An additional animal to make allowance for loss during the experiment)
Step 2: Enter in vivo formulation (This is only a calculator, not the exact formulation for a specific product. Please contact us first if there is no in vivo formulation in the solubility section.)
+
+
+

Calculation results

Working concentration mg/mL;

Method for preparing DMSO stock solution mg drug pre-dissolved in μL DMSO (stock solution concentration mg/mL). Please contact us first if the concentration exceeds the DMSO solubility of the batch of drug.

Method for preparing in vivo formulation:Take μL DMSO stock solution, next add μL PEG300, mix and clarify, next addμL Tween 80, mix and clarify, next add μL ddH2O,mix and clarify.

(1) Please be sure that the solution is clear before the addition of next solvent. Dissolution methods like vortex, ultrasound or warming and heat may be used to aid dissolving.
             (2) Be sure to add the solvent(s) in order.

Contact Us