| ln Vitro |
1. miRNA Resuspension 1.1 Briefly centrifuge the tube to ensure the dried miRNA precipitates at the bottom. 1.2 Resuspend the miRNA in nuclease-free water to prepare a 20 μM stock solution. 5 nmol miRNA: Add 250 μL nuclease-free water. 20 nmol miRNA: Add 1000 μL nuclease-free water. 1.3 Aliquot the miRNA into one or more tubes to minimize freeze-thaw cycles (<5 times). 1.4 Store at -20°C or below in a non-frost-free freezer until use. 2. Cell Preparation 2.1 Seed cells in advance for transfection. Cell viability and overall health before transfection significantly affect the transfection results. 3. Transfection 3.1 Prepare transfection mixtures A and B. 6-well plate, per well: A: 245 μL serum-free medium + 5 μL miRNA; B: 240 μL serum-free medium + 10 μL siRNA/miRNA transfection reagent. 12-well plate, per well: A: 97.5 μL serum-free medium + 2.5 μL miRNA; B: 121 μL serum-free medium + 4 μL siRNA/miRNA transfection reagent. 24-well plate, per well: A: 48.75 μL serum-free medium + 1.25 μL miRNA; B: 47.5 μL serum-free medium + 2.5 μL siRNA/miRNA transfection reagent. 96-well plate, per well: A: 24.75 μL serum-free medium + 0.25 μL miRNA; B: 24.5 μL serum-free medium + 0.5 μL siRNA/miRNA transfection reagent. Note: The recommended working concentration of miRNA mimics is 50 nM. The function of miRNAs may vary depending on the miRNA species, cell line, and selected analytical method. To determine the optimal concentration, optimization experiments should be performed using different concentrations of mimics/inhibitors. An optimization range of 10 to 200 nM is recommended. If using other transfection reagents, the amount of transfection reagent needs to be adjusted accordingly. 3.2 Gently mix A and B. Incubate at room temperature for 15 minutes. 3.3 Remove the cell culture medium and wash with PBS. 3.4 Add the transfection mixture (A+B) to the cells. For each well in a 6-well plate: Add 1500 μL of serum-free medium, then add 500 μL of transfection mixture (A+B), and mix thoroughly. For each well in a 12-well plate: Add 800 μL of serum-free medium, then add 200 μL of transfection mixture (A+B), and mix thoroughly. For each well of a 24-well plate: add 400 μL of serum-free medium, then add 100 μL of transfection mixture (A+B), and mix thoroughly. For each well of a 96-well plate: add 50 μL of serum-free medium, then add 50 μL of transfection mixture (A+B), and mix thoroughly. 3.5 Incubate cells at 37°C for 1–3 days. Then analyze the transfected cells. If necessary, replace with fresh serum-containing medium after 6 hours. Note: Antibiotics increase toxicity and should therefore be avoided during transfection. Medium containing polyanions such as heparin, heparin sulfate, or dextran sulfate will inhibit transfection.
|
|---|
| Related CAS # |
mmu-let-7a-2-3p agomir
|
|---|---|
| Sequence |
CUGUACAGCCUCCUAGCUUUCCUGCAUGUUCCCAGGUUGAGGUAGUAGGUUGUAUAGUUUAGAGUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCUUGGGACUUGCAC
|
| Appearance |
Typically exists as solids at room temperature
|
| HS Tariff Code |
2934.99.9001
|
| Storage |
Powder -20°C 3 years 4°C 2 years In solvent -80°C 6 months -20°C 1 month |
| Shipping Condition |
Room temperature (This product is stable at ambient temperature for a few days during ordinary shipping and time spent in Customs)
|
| Solubility (In Vitro) |
May dissolve in DMSO (in most cases), if not, try other solvents such as H2O, Ethanol, or DMF with a minute amount of products to avoid loss of samples
|
|---|---|
| Solubility (In Vivo) |
Note: Listed below are some common formulations that may be used to formulate products with low water solubility (e.g. < 1 mg/mL), you may test these formulations using a minute amount of products to avoid loss of samples.
Injection Formulations
Injection Formulation 1: DMSO : Tween 80: Saline = 10 : 5 : 85 (i.e. 100 μL DMSO stock solution → 50 μL Tween 80 → 850 μL Saline)(e.g. IP/IV/IM/SC) *Preparation of saline: Dissolve 0.9 g of sodium chloride in 100 mL ddH ₂ O to obtain a clear solution. Injection Formulation 2: DMSO : PEG300 :Tween 80 : Saline = 10 : 40 : 5 : 45 (i.e. 100 μL DMSO → 400 μLPEG300 → 50 μL Tween 80 → 450 μL Saline) Injection Formulation 3: DMSO : Corn oil = 10 : 90 (i.e. 100 μL DMSO → 900 μL Corn oil) Example: Take the Injection Formulation 3 (DMSO : Corn oil = 10 : 90) as an example, if 1 mL of 2.5 mg/mL working solution is to be prepared, you can take 100 μL 25 mg/mL DMSO stock solution and add to 900 μL corn oil, mix well to obtain a clear or suspension solution (2.5 mg/mL, ready for use in animals). View More
Injection Formulation 4: DMSO : 20% SBE-β-CD in saline = 10 : 90 [i.e. 100 μL DMSO → 900 μL (20% SBE-β-CD in saline)] Oral Formulations
Oral Formulation 1: Suspend in 0.5% CMC Na (carboxymethylcellulose sodium) Oral Formulation 2: Suspend in 0.5% Carboxymethyl cellulose Example: Take the Oral Formulation 1 (Suspend in 0.5% CMC Na) as an example, if 100 mL of 2.5 mg/mL working solution is to be prepared, you can first prepare 0.5% CMC Na solution by measuring 0.5 g CMC Na and dissolve it in 100 mL ddH2O to obtain a clear solution; then add 250 mg of the product to 100 mL 0.5% CMC Na solution, to make the suspension solution (2.5 mg/mL, ready for use in animals). View More
Oral Formulation 3: Dissolved in PEG400  (Please use freshly prepared in vivo formulations for optimal results.) |
Calculation results
Working concentration: mg/mL;
Method for preparing DMSO stock solution: mg drug pre-dissolved in μL DMSO (stock solution concentration mg/mL). Please contact us first if the concentration exceeds the DMSO solubility of the batch of drug.
Method for preparing in vivo formulation::Take μL DMSO stock solution, next add μL PEG300, mix and clarify, next addμL Tween 80, mix and clarify, next add μL ddH2O,mix and clarify.
(1) Please be sure that the solution is clear before the addition of next solvent. Dissolution methods like vortex, ultrasound or warming and heat may be used to aid dissolving.
(2) Be sure to add the solvent(s) in order.